Bioinformatics tools
for researchers
Free, browser-based tools for sequence analysis, format conversion, and protein research. No installation required, complete privacy guaranteed.
Everything you need for bioinformatics research
Powerful tools designed by researchers, for researchers. All processing happens in your browser for maximum privacy and speed.
Structure Prediction
Predict protein structures from sequences using advanced algorithms
Coming SoonBuilt for modern research workflows
Our tools are designed with the modern researcher in mind. No more complex installations, command-line interfaces, or data privacy concerns. Just powerful, reliable tools that work instantly.
Privacy First
All processing happens locally in your browser. Your data never leaves your device.
Lightning Fast
No server delays or upload times. Results appear instantly as you work.
Easy to Use
Intuitive interfaces designed for both beginners and expert researchers.
FASTQ to FASTA Converter
Live ToolGATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCFCCCCCCC65
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
Stay ahead of the research curve
Get insights from the latest computational biology papers, explained clearly with practical implications for your research.
Hybrid AI system beats AlphaFold at predicting complex protein structures
D-I-TASSER combines deep learning with physics-based simulations to achieve superior accuracy on difficult proteins and multi-domain structures.
Read the summary