FASTQ to FASTA converter
Convert FASTQ sequencing files to FASTA format. Upload a FASTQ file or paste the sequencing data below.
FASTA and FASTQ are the two most common formats for storing biological sequences. FASTA contains only sequence identifiers and nucleotide sequences, while FASTQ additionally stores quality scores for each base—a record of the sequencing confidence at every position.
Converting from FASTQ to FASTA means stripping away the quality information, leaving only the sequence identifiers and sequences themselves. This is necessary when downstream tools don't require or accept quality scores, or when you need to reduce file size for storage or transmission.
We recommend this tool when preparing sequences for tools that require FASTA format (like BLAST or phylogenetic alignment), sharing data where quality scores are unnecessary, or when archiving sequences long-term and file size matters. If you need the opposite conversion—adding synthetic quality scores to FASTA files—use our FASTA to FASTQ converter instead.
A FASTQ file contains four lines per sequence record:
1@SEQ_ID description2GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT3+4!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65@, containing the sequence identifier and optional description+, optionally repeating the identifierThe quality line encodes confidence in each base call using the Phred scale.
Quality scores in FASTQ use the Phred scale, a logarithmic representation of sequencing error probability:
Where is the Phred quality score and is the probability the base call is incorrect. Rearranged to calculate error probability from quality:
| Phred Score | Error Probability | Base Call Accuracy | Typical Sequencing Platform |
|---|---|---|---|
| Q10 | 1 in 10 (10%) | 90% | Low-quality reads or problematic bases |
| Q20 | 1 in 100 (1%) | 99% | Standard quality threshold for most work |
| Q30 | 1 in 1,000 (0.1%) | 99.9% | High-quality Illumina sequencing |
| Q40 | 1 in 10,000 (0.01%) | 99.99% | Excellent sequencing data |
Modern Illumina sequencers typically produce reads with average quality scores between Q30-Q40 at the beginning of reads. Oxford Nanopore and PacBio long-read sequencers often generate lower average scores (Q10-Q20) due to their different technology.
FASTQ files encode quality scores as single ASCII characters for compact storage. The standard encoding (Phred+33, used by Illumina 1.8+, Sanger, and modern sequencers) adds 33 to the Phred score and converts to the corresponding ASCII character:
!+5?IThis tool uses the standard Phred+33 encoding, which is supported by all major bioinformatics software.
When converting FASTQ to FASTA, you can optionally filter sequences based on their average quality score:
Converts all sequences, preserving them exactly as they appear in the FASTQ file. Use this when you want to keep all data regardless of quality.
Keeps only sequences with an average quality score of 10 or higher. This removes the very lowest quality reads but allows marginal data through. Rarely used except when data is extremely limited.
Filters sequences to keep only those with average quality of 20 or higher. This is the standard quality threshold for most bioinformatics work and removes obviously problematic data while retaining usable reads.
Keeps only sequences with average quality of 30 or higher. This is a stringent threshold suitable for applications where accuracy is critical, such as variant calling or quality-sensitive downstream analysis. May remove a significant portion of your data.
No filtering if your downstream tool doesn't require quality filtering, or if you're preserving the original dataQ20+ for most standard workflows and general analysisQ30+ for strict quality standards (variant detection, medical diagnostics, mutation discovery)Q10+ only when working with challenging samples where data is limitedEnabling this optional setting adds the sequence's average quality score to the FASTA header line. This preserves quality metadata even after converting away the quality scores themselves:
1>SEQ_ID description | avg_qual=28.52GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTTThis is useful when you need FASTA format but want to track which sequences had high versus low quality, or for documenting the original data quality in your analysis records.
Use this tool for:
Many bioinformatics tools don't use or even accept quality scores. Phylogenetic analysis, BLAST searches, and many sequence alignment methods only look at the sequence itself. Removing quality scores also reduces file size—FASTA files are typically one-fourth to one-fifth the size of FASTQ files.
For most analyses, use Q20+ as the standard. This removes only obviously problematic bases while retaining the bulk of your data. Choose Q30+ only if accuracy is critical (variant calling, medical diagnostics). Use No filtering only if you have a specific reason to keep low-quality sequences.
Yes. The tool accepts both DNA (A, T, G, C) and RNA (A, U, G, C) sequences. Sequences containing N bases are converted as-is and pass through all quality filters.
Yes. Upload a multi-sequence FASTQ file or paste multiple FASTQ records (as long as each record is properly formatted with 4 lines), and they will all be converted to FASTA format simultaneously. Each sequence is processed independently.
Filtered sequences are removed from the output entirely. If you enable the quality info in headers option, you can re-run the conversion with No filtering afterward to see which sequences would have been removed and their quality scores. Alternatively, your FASTQ file still contains all original records if you need to recover filtered sequences later.