DNAGenIQ (Random DNA sequence generator)
v2.0.0Generate random DNA sequences with controlled length, GC content, and restriction sites.
Generate random DNA sequences with controlled length, GC content, and restriction sites.
Choose the number of sequences, their requested length, and a target GC percentage, then run DNAGenIQ to create DNA in FASTA format. It samples each base independently, so every run produces a new result. The page returns copyable sequence text and can download the same output as a .fasta file.
For example, one 12 bp sequence at a 50% GC target returns a FASTA record like this. This is a verified run of the generator, but a later run with the same settings will have different bases and can have a different measured GC percentage.
>DNA_Sequence_1 length=12bp GC=75.0%
GTCGGTCCCGCATo place the same cloning site at both ends, enable restriction sites and choose the enzyme. With Number of sequences set to 2, Sequence length (bp) to 20, GC content (%) to 50, and EcoRI selected, a verified run produced:
>DNA_Sequence_1 length=20bp GC=50.0%
GAATTCGTCGGTCCGAATTC
>DNA_Sequence_2 length=20bp GC=40.0%
GAATTCCGCACAATGAATTCEach sequence begins and ends with GAATTC, the EcoRI recognition sequence. The bases between those sites are randomly sampled.
DNAGenIQ is a generator, so it does not accept a sequence, FASTA file, or other upload.
| Input | Requirements |
|---|---|
| Existing sequence or file | None. Configure the settings and generate new DNA. |
| Alphabet in generated sequence | A, C, G, and T only. |
| Number of sequences | At least 1. |
| Setting | What it controls | Options and default |
|---|---|---|
Number of sequences | The number of separate FASTA records to generate. | Number setting. Use a whole number of at least 1, default 1. |
Sequence length (bp) | The total length for each record, including inserted restriction sites. | Whole number of at least 1, default 200. |
GC content (%) | The probability that a sampled base is G or C rather than A or T. It is a target, not an exact composition constraint. | 0 to 100%, including decimal values, default 50. |
Add restriction sites | Adds one copy of the selected recognition sequence to the beginning and another to the end of every record. | On or off, default off. |
Restriction sites | Selects the recognition sequence used when Add restriction sites is enabled. | EcoRI (GAATTC, default), BamHI (GGATCC), HindIII (AAGCTT), PstI (CTGCAG), XbaI (TCTAGA), or SalI (GTCGAC). This setting appears only when restriction sites are enabled. |
| Result | Contents |
|---|---|
| FASTA text | One record per generated sequence, separated by a blank line. |
| FASTA header | DNA_Sequence_ followed by its one-based number, then length= in bp and the measured GC= percentage rounded to one decimal place. |
| Download | The generated FASTA text as a .fasta file. |
The generator samples G or C with probability GC content / 100; when it does, G and C are equally likely. Otherwise, it samples A and T with equal probability. As a result, shorter sequences naturally vary more around the target than longer ones. The FASTA header reports the actual composition of each sequence, which is the value to use when a downstream analysis needs an exact GC content.
Restriction sites also affect the measured value because their bases are fixed. The requested length includes the site at each end. Select a length at least twice the recognition-sequence length: at least 12 bp for EcoRI, BamHI, HindIII, PstI, XbaI, or SalI. A shorter request returns an error before any sequence is generated.
At 0% GC, the random portion contains only A and T; at 100%, it contains only G and C. Fixed restriction sites still retain their own bases. Targets below 20% or above 80% display a notice to check the sequence before using it in an experiment.
For a biologically plausible control, use the GC content of the sequences being compared and assess the generated output after creation. DNAGenIQ does not enforce a precise GC percentage, avoid motifs, remove repeats, or predict secondary structure. For a random rearrangement that preserves the composition of an existing sequence, use DNA shuffle instead.
| Goal | Best tool |
|---|---|
| Make new A/C/G/T sequences with a chosen length and approximate GC content | DNAGenIQ, the random DNA generator |
| Randomize the order of an existing DNA sequence while retaining its composition | DNA shuffle |
| Introduce substitutions, insertions, deletions, or a variant library into an existing sequence | DNA mutation generator |
| Make a synthetic RNA sequence rather than DNA | random RNA generator |
| Find the reverse-complement strand of a sequence already in hand | reverse complement |
No. Bases are sampled randomly each time the generator runs. Re-run it to produce a fresh set of sequences, and save the FASTA output when a particular sequence must be reused.
No. The setting controls the sampling probability for the random portion of each sequence. Read the GC= value in each FASTA header to see the actual percentage, especially for short sequences or sequences with fixed restriction sites.
The selected recognition sequence is placed at both termini, once at the start and once at the end. It is not inserted at an internal position.
Treat it as a starting sequence, not a validated construct. Check the final sequence for unwanted internal restriction sites, repeats, open reading frames, secondary structure, and the requirements of the vector and host before ordering or cloning it.
Optimize coding DNA for a target organism with DNA Chisel while preserving its translation.
Mutate DNA online by exact count or mutation rate, with reproducible controls and FASTA export.
Generate random protein sequences with controlled length, amino acid composition, and motifs.
Generate random RNA test sequences with adjustable GC content and optional RNA-like templates and sequence motifs.
Shuffle DNA sequences while preserving nucleotide, dinucleotide, or k-mer composition.
Generate ligand protonation states over a pH range with Dimorphite-DL.
Design overlapping peptide libraries with adjustable length, overlap and terminal restrictions. Runs in your browser.
Enumerate stereoisomers from SMILES while preserving assigned stereochemistry by default.
Convert CSV or TSV sequence tables to FASTA with automatic delimiter detection and column mapping.
Translate DNA sequences into proteins across reading frames and genetic code tables.