DNAGenIQ - Random DNA sequence generator

How to generate a random DNA sequence

Choose the number of sequences, their requested length, and a target GC percentage, then run DNAGenIQ to create DNA in FASTA format. It samples each base independently, so every run produces a new result. The page returns copyable sequence text and can download the same output as a .fasta file.

For example, one 12 bp sequence at a 50% GC target returns a FASTA record like this. This is a verified run of the generator, but a later run with the same settings will have different bases and can have a different measured GC percentage.

>DNA_Sequence_1 length=12bp GC=66.7%
GTCCGTGTCCGT

To place the same cloning site at both ends, enable restriction sites and choose the enzyme. With Number of sequences set to 2, Sequence length (bp) to 20, GC content (%) to 50, and EcoRI selected, a verified run produced:

>DNA_Sequence_1 length=20bp GC=45.0%
GAATTCGTCCGTGTGAATTC

>DNA_Sequence_2 length=20bp GC=50.0%
GAATTCCCGTGTCCGAATTC

Each sequence begins and ends with GAATTC, the EcoRI recognition sequence. The bases between those sites are randomly sampled.

Input

DNAGenIQ is a generator, so it does not accept a sequence, FASTA file, or other upload.

Settings

Results

Choosing length and GC content

The generator samples G or C with probability GC content / 100; when it does, G and C are equally likely. Otherwise, it samples A and T with equal probability. As a result, shorter sequences naturally vary more around the target than longer ones. The FASTA header reports the actual composition of each sequence, which is the value to use when a downstream analysis needs an exact GC content.

Restriction sites also affect the measured value because their bases are fixed. The requested length includes the site at each end. Select a length at least twice the recognition-sequence length: at least 12 bp for EcoRI, BamHI, HindIII, PstI, XbaI, or SalI. If a shorter length is requested with restriction sites enabled, the generator still writes both sites and the returned sequence is longer than the requested length.

For a biologically plausible control, use the GC content of the sequences being compared and assess the generated output after creation. DNAGenIQ does not enforce a precise GC percentage, avoid motifs, remove repeats, or predict secondary structure. For a random rearrangement that preserves the composition of an existing sequence, use DNA shuffle instead.

Which DNA generator should I use?

FAQ

Does the random DNA generator make the same sequence every time?

No. Bases are sampled randomly each time the generator runs. Re-run it to produce a fresh set of sequences, and save the FASTA output when a particular sequence must be reused.

Is the GC content exactly the value I enter?

No. The setting controls the sampling probability for the random portion of each sequence. Read the GC= value in each FASTA header to see the actual percentage, especially for short sequences or sequences with fixed restriction sites.

Where are restriction sites placed in generated DNA?

The selected recognition sequence is placed at both termini, once at the start and once at the end. It is not inserted at an internal position.

Can I use a random DNA sequence directly for cloning?

Treat it as a starting sequence, not a validated construct. Check the final sequence for unwanted internal restriction sites, repeats, open reading frames, secondary structure, and the requirements of the vector and host before ordering or cloning it.