
Convert CSV or TSV sequence tables to FASTA with automatic delimiter detection and column mapping. Learn more

Convert CSV or TSV sequence tables to FASTA with automatic delimiter detection and column mapping. Learn more

Convert TXT or plain text sequences into FASTA format files for DNA, RNA, and protein workflows with cleanup, validation, and downloads

Extract sequence features (CDS, mRNA, gene, etc.) from GenBank files in FASTA format with support for spliced features

Convert FASTA sequence files to FASTQ format with mock quality scores

Convert standard FASTQ reads to FASTA with validation, IUPAC nucleotide support, average-quality filtering, and downloadable summaries

Convert GenBank files to FASTA format

Translate DNA sequences to protein sequences using genetic code

Convert DNA sequences to RNA (transcription) - replaces T with U

Reverse translate protein sequences to possible DNA sequences

Convert RNA sequences to DNA (reverse transcription) - replaces U with T

Convert single-letter amino acid codes to three-letter codes

Convert TXT or plain text sequences into FASTA format files for DNA, RNA, and protein workflows with cleanup, validation, and downloads

Extract sequence features (CDS, mRNA, gene, etc.) from GenBank files in FASTA format with support for spliced features

Convert FASTA sequence files to FASTQ format with mock quality scores

Convert standard FASTQ reads to FASTA with validation, IUPAC nucleotide support, average-quality filtering, and downloadable summaries

Convert GenBank files to FASTA format

Translate DNA sequences to protein sequences using genetic code

Convert DNA sequences to RNA (transcription) - replaces T with U

Reverse translate protein sequences to possible DNA sequences

Convert RNA sequences to DNA (reverse transcription) - replaces U with T

Convert single-letter amino acid codes to three-letter codes
Configure inputs to begin
Set options on the left, then click “Convert”.
CSV to FASTA converts sequence tables into FASTA records. Spreadsheet exports often store identifiers, DNA, RNA, protein sequences, and notes in separate columns, while many sequence analysis tools expect FASTA input with one header line and one or more sequence lines.
The FASTA convention is simple: each record starts with a definition line beginning with >, followed by the sequence. NCBI GenBank FASTA format guidance emphasizes a unique sequence identifier on the definition line, which is why column mapping matters when converting spreadsheet data.
CSV and TSV files are useful for data management, sample sheets, vendor ordering, and metadata review. FASTA is better suited for search, alignment, translation, phylogenetics, and sequence-property tools. This converter bridges those workflows by turning selected table columns into clean FASTA records.
The converter reads delimited text, detects or applies the selected delimiter, identifies the ID and sequence columns, then writes each row as a FASTA record. With a header row, it can recognize common identifier columns such as id, name, header, accession, and gene_id, and sequence columns such as sequence, seq, protein, dna, and rna.
CSV parsing follows normal spreadsheet behavior for quoted fields. RFC 4180 describes the common CSV rules used for fields that contain commas, quotes, or line breaks. ProteinIQ supports quoted fields with embedded delimiters and multiline quoted sequence cells, which helps with spreadsheet exports that wrap long sequences.
After parsing, sequence cleanup can remove spaces, numbers, punctuation, and non-sequence characters. Alignment gaps (-) and protein stop markers (*) are treated as biological sequence characters and preserved by default. Validation classifies rows as DNA, RNA, protein, mixed, or unknown, and warnings are shown when rows are skipped, cleaned, or contain invalid characters.
ProteinIQ's converter runs entirely in the browser. No sequence data is uploaded to external servers for conversion. Maximum upload size: 50 MB per file, and account tier file-count limits may apply.
| Input format | Use when |
|---|---|
| CSV | Your table uses commas between columns. |
| TSV | Your table uses tabs between columns. |
| Spreadsheet export | CSV exported from Excel or spreadsheet software. |
| Other delimited text | Your table uses semicolons or pipe characters. |
At minimum, the input needs one identifier column and one sequence column. Additional metadata columns are ignored by the FASTA output, but the results panel reports the detected delimiter and columns found so you can confirm the conversion.
| Setting | Default | Purpose |
|---|---|---|
Delimiter | Auto-detect | Choose comma, tab, semicolon, pipe, or let the converter infer it. |
Has header row | On | Treat the first row as column names. |
Quote character | " | Parse fields that contain delimiters or line breaks. |
Use column indices | Off | Select columns by zero-based position instead of name. |
Line wrapping | 80 | Wrap FASTA sequence lines at 60, 80, or not at all. |
Case format | UPPERCASE | Uppercase, lowercase, or preserve sequence case. |
Skip invalid sequences | Off | Keep invalid rows with warnings, or exclude them. |
The output is standard FASTA text:
>seq1
ATCGATCGATCGATCGATCG
>seq2
GCTAGCTAGCTAGCTAGCTAResults can be copied to the clipboard or downloaded as a .fasta file.
Galaxy Tabular-to-FASTA converts tabular datasets into FASTA records inside Galaxy histories, which is useful when the conversion is one step in a larger Galaxy workflow. The CDC CSV2FASTA page provides a simple browser tool for CSV-to-FASTA and FASTA-to-CSV conversion, including BEAST-oriented date handling. OligoPool's format converter supports bidirectional FASTA, CSV, TSV, and plain-text conversion for oligo workflows.
Use ProteinIQ's CSV to FASTA converter when your sequence data is already in table form and you need browser-local conversion with delimiter detection, column mapping, cleanup warnings, and downloadable FASTA output.
For other input formats, use TXT to FASTA when your input is plain sequence text, FASTQ to FASTA when you need to remove quality-score records from sequencing reads, GenBank to FASTA for annotated GenBank files, or PDB to FASTA when you need sequences from structure files. Use FASTA to FASTQ when a downstream workflow requires FASTQ-style records with mock quality scores.