
CSV to FASTA
Convert CSV or TSV sequence tables to FASTA with automatic delimiter detection and column mapping.
Related tools

TXT to FASTA converter
Convert plain text sequences to FASTA format - supports DNA, RNA, and protein sequences with automatic cleanup and validation

GenBank Feature Extractor
Extract sequence features (CDS, mRNA, gene, etc.) from GenBank files in FASTA format with support for spliced features

FASTA to FASTQ Converter
Convert FASTA sequence files to FASTQ format with mock quality scores

FASTQ to FASTA converter
Convert FASTQ sequence files to FASTA format

GenBank to FASTA Converter
Convert GenBank files to FASTA format

DNA to Protein Converter
Translate DNA sequences to protein sequences using genetic code

DNA to RNA converter
Convert DNA sequences to RNA (transcription) - replaces T with U

Protein to DNA converter
Reverse translate protein sequences to possible DNA sequences

RNA to DNA converter
Convert RNA sequences to DNA (reverse transcription) - replaces U with T

PDB to FASTA converter
Convert Protein Data Bank files to FASTA sequence format
What is CSV to FASTA?
CSV to FASTA converts tabular sequence data—stored in CSV, TSV, or other delimited formats—into FASTA format. Spreadsheets and databases often store sequences alongside metadata in columns, but most bioinformatics tools expect FASTA input. This converter bridges that gap.
The tool handles common spreadsheet quirks: quoted fields containing commas, inconsistent delimiters, and extraneous characters mixed into sequence columns. It auto-detects column names and delimiters, though manual overrides are available when needed.
How to use CSV to FASTA online
ProteinIQ's converter runs entirely in the browser—no uploads to external servers, no software installation. Large files process instantly on the client.
Input
| Format | Description |
|---|---|
| CSV | Comma-separated values |
| TSV | Tab-separated values |
| Other delimited | Semicolon or pipe-delimited files |
The converter expects at least two columns: one for sequence identifiers (headers) and one for the sequences themselves. Additional metadata columns are ignored.
Settings
CSV parsing
| Setting | Description |
|---|---|
Delimiter | Auto-detect (default), Comma, Semicolon, Tab, or Pipe. Auto-detection examines the first few rows. |
Has header row | Whether the first row contains column names. Default: on. |
Quote character | Character used to wrap fields containing delimiters. " (default), ', or None. |
Column mapping
The converter looks for common column names automatically: "id", "name", "header" for identifiers; "sequence", "seq", "protein" for sequences. Override these when your columns use different names.
| Setting | Description |
|---|---|
Use column indices | Map by position (0-indexed) instead of column name. Useful for headerless files. |
ID column name | Column containing sequence identifiers. Default: id. |
Sequence column name | Column containing sequences. Default: sequence. |
ID column index | Zero-based position of the ID column (when using indices). |
Sequence column index | Zero-based position of the sequence column (when using indices). |
FASTA formatting
| Setting | Description |
|---|---|
Line wrapping | 80 characters (default), 60, or no wrapping. Standard FASTA uses 60–80. |
Case format | UPPERCASE (default), lowercase, or Preserve original. |
Header prefix | Optional text prepended to all FASTA headers. |
Sequence cleanup
Spreadsheet data often contains formatting artifacts—position numbers, spaces for readability, or stray punctuation. The cleanup options remove these automatically.
| Setting | Description |
|---|---|
Character cleanup | Master toggle for cleanup options. Default: on. |
Remove spaces | Strip whitespace. Default: on. |
Remove numbers | Strip digits 0–9. Default: on. |
Remove punctuation | Strip punctuation marks. Default: on. |
Remove invalid characters | Strip characters not valid in biological sequences. Default: on. |
Validation
| Setting | Description |
|---|---|
Validate sequences | Check for invalid characters after cleanup. Default: on. |
Skip empty rows | Ignore rows with missing sequence values. Default: on. |
Skip invalid sequences | Exclude sequences that fail validation instead of including them with warnings. Default: off. |
Show sequence statistics | Display count, total length, and detected sequence type. Default: on. |
Output
The converter produces standard FASTA with headers beginning with > followed by the identifier, then sequence lines wrapped at the specified length.
1>seq12ATCGATCGATCGATCGATCG3>seq24GCTAGCTAGCTAGCTAGCTAResults can be copied to clipboard or downloaded as a .fasta file.