Calculate primer Tm and oligo properties, then check contiguous hairpin, self-dimer, and heterodimer complementarity in one instant analysis. Learn more
Calculate primer Tm and oligo properties, then check contiguous hairpin, self-dimer, and heterodimer complementarity in one instant analysis. Learn more

Identify CpG islands in DNA sequences using the Gardiner-Garden and Frommer criteria. Analyze GC content, CpG density, and observed/expected ratios.

Calculate GC content, GC/AT skew, melting temperature, and CpG islands for DNA/RNA sequences, with a sliding-window GC plot. Analyze individual sequences or get combined statistics.

Assess docking model quality by comparing predicted complexes against native references. DockQ v2.1.3 supports protein, nucleic-acid, and supported small-molecule interfaces with faithful native metrics.

Isoelectric Point Calculator 2.0 - Predict protein/peptide isoelectric point (pI) using 18+ validated pKa scales, SVR models, and deep learning. Supports proteins, peptides, and comprehensive analysis.

Carbon is a DNA language model for generation, scoring, and sequence comparison using the native Hugging Face Carbon model family.

Find open reading frames in DNA with the native NCBI ORFfinder search, translations, coordinates, and output files.

Faithful static-mode Aggrescan3D tool for per-residue aggregation propensity analysis from a single protein structure.

Plot net charge vs pH for protein sequences. Visualize how protein charge changes across pH 0-14 and identify the isoelectric point (pI) where the net charge crosses zero.

Match experimental peptide masses against theoretical digest fragments of a protein sequence. Identify peptides from mass spectrometry data by peptide mass fingerprinting.

Generate Kyte-Doolittle hydropathy plots to visualize hydrophobic and hydrophilic regions along protein sequences. Identify transmembrane domains and surface-exposed regions.

Identify CpG islands in DNA sequences using the Gardiner-Garden and Frommer criteria. Analyze GC content, CpG density, and observed/expected ratios.

Calculate GC content, GC/AT skew, melting temperature, and CpG islands for DNA/RNA sequences, with a sliding-window GC plot. Analyze individual sequences or get combined statistics.

Assess docking model quality by comparing predicted complexes against native references. DockQ v2.1.3 supports protein, nucleic-acid, and supported small-molecule interfaces with faithful native metrics.

Isoelectric Point Calculator 2.0 - Predict protein/peptide isoelectric point (pI) using 18+ validated pKa scales, SVR models, and deep learning. Supports proteins, peptides, and comprehensive analysis.

Carbon is a DNA language model for generation, scoring, and sequence comparison using the native Hugging Face Carbon model family.

Find open reading frames in DNA with the native NCBI ORFfinder search, translations, coordinates, and output files.

Faithful static-mode Aggrescan3D tool for per-residue aggregation propensity analysis from a single protein structure.

Plot net charge vs pH for protein sequences. Visualize how protein charge changes across pH 0-14 and identify the isoelectric point (pI) where the net charge crosses zero.

Match experimental peptide masses against theoretical digest fragments of a protein sequence. Identify peptides from mass spectrometry data by peptide mass fingerprinting.

Generate Kyte-Doolittle hydropathy plots to visualize hydrophobic and hydrophilic regions along protein sequences. Identify transmembrane domains and surface-exposed regions.
Configure inputs to begin
Set options on the left, then click “Analyze”.
Paste one unmodified DNA oligo in the 5′ to 3′ direction. The analyzer calculates nearest-neighbor melting temperature, GC content, molecular weight, A260 properties, and contiguous hairpin and self-dimer matches. Add a comparison oligo to check a primer pair for heterodimer complementarity under the same concentration and salt conditions.
For example, analyze this 28 nt primer at the default 250 nM total strand concentration and 50 mM Na+:
CGTTCCAAAGATGTGGGCATGAGCTTACThe verified result is:
Length: 28 nt
GC content: 50.0%
Nearest-neighbor Tm: 61.9 °C
Molecular weight: 8,628.7 g/mol
Extinction coefficient: 303,580 M^-1 cm^-1
nmol/OD260: 3.29
µg/OD260: 28.42
Hairpin screen: Low signal, strongest stem 3 bp with a 6 nt loop
Self-dimer screen: Low signal, longest contiguous run 2 bpFor a primer-pair check, enter one sequence in each oligo field:
Primary oligo: AGGCTGATCGTACGATGCTA
Comparison oligo: TACGGCATCCAGTTGAGTCAAt the default conditions, their Tm values are 54.8 °C and 55.1 °C. The strongest heterodimer alignment has a 3 bp contiguous run at a 3′ end, so the screen marks it for review.
| Input | Accepted value | Limits | Behavior |
|---|---|---|---|
| Primary oligo | One DNA sequence using A, C, G, and T | 8 to 120 nt | Required. Enter the strand in the 5′ to 3′ direction. |
| Comparison oligo | One DNA sequence using A, C, G, and T | 8 to 120 nt | Optional. Adds a primer-pair heterodimer screen. |
| Text | Raw sequence or one FASTA record | Whitespace is ignored | Lowercase bases are converted to uppercase. |
| File | .txt, .fasta, .fa, .fas, or .seq | Up to 1 MB per input | Each input must contain one oligo. |
Ambiguous bases such as N, RNA U, modifications, mixed-base notation, multiple FASTA records, and punctuation are rejected. Convert an RNA sequence to DNA first if U should be treated as T. The calculator does not infer or approximate modified-base chemistry.
| Setting | What it controls | Allowed values | Default |
|---|---|---|---|
Total strand concentration (nM) | Total concentration of both strands in the non-self-complementary duplex model. Tm uses the standard concentration term. | 1 to 100,000 nM | 250 nM |
Na+ concentration (mM) | Monovalent sodium concentration used in the SantaLucia entropy correction. | 1 to 1,000 mM | 50 mM |
Minimum hairpin loop (nt) | Smallest unpaired loop allowed between two contiguous complementary stem arms. | 3 to 30 nt | 3 nt |
The Tm model does not include Mg2+, K+, Tris, dNTP binding, DMSO, formamide, mismatches, dangling ends, or chemical modifications. Use conditions that reflect the monovalent component of the intended experiment, and treat a calculated Tm as a model estimate rather than a measured transition temperature.
| Result | Meaning |
|---|---|
Nearest-neighbor Tm | DNA/DNA duplex melting temperature from the Allawi and SantaLucia nearest-neighbor parameters with the SantaLucia 1998 monovalent-salt entropy correction. |
GC content and Base counts | Fraction and count of G and C, plus counts for all four DNA bases. |
Molecular weight | Average molecular mass of unmodified single-stranded DNA with 5′ and 3′ hydroxyl ends, in g/mol. |
Extinction coefficient | Base-composition estimate at 260 nm, in M^-1 cm^-1. |
nmol per OD260 and µg per OD260 | Amount corresponding to one absorbance unit in a 1 cm path length, derived from the extinction coefficient and molecular weight. |
Reverse complement | Reverse-complement sequence in the 5′ to 3′ direction. For a dedicated transform, use the reverse complement tool. |
Primer checks | Practical review flags for 40% to 60% GC, 55 °C to 65 °C Tm, homopolymer length, and the final five-base GC clamp. These are common design ranges, not universal pass or fail rules. |
Hairpin screen | Up to five gapless, contiguous Watson-Crick stems with dot-bracket notation, stem length, loop length, GC pairs, and 3′ involvement. |
Self-dimer screen | Up to five antiparallel self-alignments ranked by 3′ complementarity, longest contiguous run, and total paired bases. |
Primer-pair heterodimer screen | The same antiparallel screen between the primary and comparison oligos. |
Thermodynamic terms | Duplex ΔH, ΔS, and salt-adjusted ΔS used in the Tm calculation. |
CSV export contains the primary scalar properties for each oligo. Full JSON also preserves thermodynamic terms, checks, warnings, hairpin candidates, dimer alignments, and method labels.
The analyzer uses the DNA/DNA nearest-neighbor model described by Allawi and SantaLucia and summarized in Biopython's melting-temperature reference. Each adjacent base pair contributes an enthalpy and entropy term. Terminal base-pair corrections are added, followed by the SantaLucia monovalent-salt entropy correction:
The melting temperature is then:
Here, ΔH is in kcal/mol, ΔS is in cal/(mol·K), is 1.987 cal/(mol·K), is in mol/L, and is the total strand concentration in mol/L. The implementation is checked against independent Biopython DNA_NN3 fixtures at the same concentrations.
The structure screens answer a narrow, reproducible question: where can two uninterrupted DNA segments form Watson-Crick pairs in an antiparallel orientation? They report the exact alignment, the longest run, and whether a run reaches a 3′ end. Hairpins also enforce the configured minimum loop and show dot-bracket notation.
Signal labels are screening aids:
These labels do not represent free energy. The screen does not calculate ΔG, Tm for a folded structure, bulges, mismatches, internal loops, coaxial stacking, or competing structure ensembles. OligoCalc's current documentation also describes its historical homology-based hairpin and dimer checks as deprecated, while Primer3 provides a stronger thermodynamic model for consequential secondary-structure decisions. Vendor calculations can differ because their conditions, modifications, and parameter sets differ.
Molecular weight uses average residue masses for unmodified DNA and subtracts 61.96 g/mol for a strand with 5′ and 3′ hydroxyl ends, matching the convention documented by OligoCalc. A 5′ phosphate, dye, quencher, linker, phosphorothioate, or other modification changes the mass and may change absorbance.
The extinction coefficient is a base-composition estimate. It is useful for a consistent planning value, but sequence context and experimental calibration can matter. Cavaluzzi and Borer found that common base-composition and nearest-neighbor absorbance estimates can systematically differ from measured unpaired DNA values, as discussed in their revised UV extinction coefficient study.
| Goal | Tool |
|---|---|
| Review one primer or a primer pair for Tm, mass, A260 properties, hairpins, and dimers | Oligo analyzer |
| Calculate composition and sliding-window GC across longer DNA or RNA records | GC content calculator |
| Convert a strand to its opposite 5′ to 3′ sequence | Reverse complement |
| Design primers from a template with product-size and positional constraints | Primer3 |
Yes. It calculates a salt-adjusted nearest-neighbor DNA/DNA Tm from total strand concentration and Na+ concentration. It is not a Wallace-rule estimate.
Yes. Put the forward primer in Primary oligo and the second primer, written 5′ to 3′, in Comparison oligo. The heterodimer screen aligns them antiparallel and ranks 3′ complementarity first.
No. It finds gapless contiguous Watson-Crick stems and reports stem length, loop length, GC pairs, 3′ involvement, and dot-bracket notation. Use a thermodynamic secondary-structure method when ΔG or structure ensembles affect the decision.
IDT OligoAnalyzer can account for additional ions, target types, and ordered modifications. Results also change with concentration conventions and thermodynamic parameter sets. Match the stated conditions before comparing values.
No. The accepted alphabet is unambiguous DNA A, C, G, and T. Rejecting unsupported chemistry prevents a precise-looking result based on the wrong constants.
The result view flags 55 °C to 65 °C Tm and 40% to 60% GC as common PCR primer ranges. Assay chemistry, polymerase, amplicon, cycling protocol, and primer pairing determine the final target, so these ranges are review aids rather than universal requirements.