Oligo analyzer

Oligo analyzer overview

The 20-mer EGFR_reverse primer has a melting temperature of 58.7 °C at 50 mM monovalent cations, 1.5 mM Mg²⁺, 0.6 mM dNTPs and 50 nM oligo. Drop the Mg²⁺ and dNTPs and raise the oligo to 250 nM, the defaults IDT OligoAnalyzer assumes, and the same sequence calculates to 55.1 °C. Add 5% DMSO to the first set of conditions and it falls to 55.7 °C. A Tm is only comparable when its conditions and method are.

ProteinIQ's Oligo Analyzer calculates Tm, hairpin, self-dimer and heterodimer stability, 3′ end stability, GC content, molecular weight and A260 extinction coefficient for unmodified DNA oligos and primers. It runs the thermodynamic functions of Primer3 2.6.1 (Untergasser et al., 2012) through primer3-py 2.2.0, and every result records the conditions behind its numbers.

Pricing

A run costs 5 credits, whatever the number of oligos and whether interactions are analyzed. Free accounts can analyze up to 10 oligos per run and paid plans up to 96. The cost is shown before submission.

Inputs

Enter each sequence 5′ to 3′. Paste a multi-record FASTA into the sequence field or upload it as one file; each header becomes that oligo's name in the result and exports. Plain text without headers is read as one oligo per line, and unnamed lines are numbered.

>EGFR_forward
CGTTCCAAAGATGTGGGCATGAGCTTAC
>EGFR_reverse
TACGGCATCCAGTTGAGTCA

Each oligo must be unmodified DNA made only of A, C, G and T. Spaces within a line or a FASTA record are ignored and lowercase bases are read as uppercase. RNA U, IUPAC-degenerate bases such as N, R or Y, modifications and mixed-base notation are refused before the job starts, with the record and position of each unsupported base.

Primer3 calculates hairpins and dimers only up to 60 nt, so longer oligos, such as primers with sequencing adapter tails, get partial results. Their Tm, GC, mass, OD260 values and base counts are reported, and their hairpin and self-dimer values are left blank. Heterodimer and 3′ end-stability values are still calculated for a pair when at least one of the two oligos is 60 nt or shorter. Above 60 nt Primer3 also calculates Tm with a simpler formula from GC content, length and monovalent cations instead of nearest-neighbor thermodynamics, so Tm method, Salt correction and Oligo concentration no longer change it. Each job lists the affected oligos in its warnings.

Settings

Analysis

Oligo properties are always calculated for every record. With Analyze interactions on, two oligos return one primer-pair result with the difference between their Tm values, and three or more return every unordered pair, up to 276 for 24 oligos.

Reaction conditions

The four concentrations apply to every calculation. The analysis temperature changes structure ΔG only; it does not change the Tm of the oligo or of a structure.

Thermodynamic method

The defaults are Primer3's own. Tm method, Salt correction, DMSO, DMSO factor and Formamide change the oligo Tm only; Primer3's hairpin, dimer and end-stability calculations do not take them. Primer3 subtracts DMSO percent times the factor from the Tm, so 5% DMSO at the default 0.6 lowers it by 3.0 °C. Formamide lowers a 50% GC oligo's Tm by about 2.7 °C per mol/L.

The Owczarzy option uses the 2004 monovalent correction, or the 2008 Mg²⁺ correction when Mg²⁺ dominates. With the other two corrections, Primer3 converts Mg²⁺ into an equivalent monovalent concentration after subtracting the share bound by dNTPs (von Ahsen et al., 2001).

Outputs

The Data table and exports keep Primer3's units: °C, cal/mol for ΔG and ΔH, and cal/(mol·K) for ΔS. The Structures tab shows ΔG in kcal/mol.

Understanding results

Melting temperature

Tm (°C) is the temperature at which half of the oligo is bound to its perfect complement under the entered conditions, calculated with nearest-neighbor thermodynamics. Primer3's own primer design defaults aim for 60 °C within 57 to 63 °C, which is a reasonable reference for standard PCR primers, not a universal requirement. For a primer pair, the two Tm values should sit close together because both must anneal at one temperature.

SantaLucia (1998) reported that the default parameters, with Primer3's default salt correction, predicted the Tm of 26 duplexes in 0.01 to 0.3 M NaCl with an average deviation of 2.2 °C. The older Breslauer 1986 parameters missed SantaLucia's 108-duplex set by 6.0 °C on average. Owczarzy et al. (2004) reported an average error of 1.6 °C for their monovalent correction on an independent set.

Hairpins, dimers and 3′ end stability

Each structure result is the most stable structure Primer3 finds by thermodynamic alignment, reported as found status, Tm, ΔG, ΔH, ΔS and an ASCII alignment. More negative ΔG means a more stable structure at the analysis temperature. The structure Tm is the temperature at which that structure is half formed; a structure that melts well below the annealing temperature is unlikely to compete with primer binding.

Primer3's design defaults reject primers whose hairpin, self-dimer or primer-pair structure Tm exceeds 47 °C. That limit is a useful screen, not a prediction that an assay will fail. When Primer3 finds no structure, it reports 0 for every value; the Structures tab shows No structure found, while Data and the exports keep the zeros next to a false found status.

3′ end stability aligns one oligo's 3′ end against its partner, in both directions. A stable 3′ end interaction matters most because a polymerase can extend it and produce primer dimers. Primer3 reports a Tm for it too, which is often far below 0 °C for short end contacts; read it alongside ΔG.

Worked example

Run on the two EGFR primers above at default conditions with Analyze interactions on, the forward primer gives a Tm of 66.3 °C and the reverse 58.7 °C, a pair ΔTm of 7.6 °C. Primer3's design window of 57 to 63 °C would not accept the forward primer, so a pair this far apart is worth redesigning or annealing with care.

The forward primer has a hairpin with a Tm of 41.7 °C and a ΔG of −0.31 kcal/mol at 37 °C, below the 47 °C screen. Its self-dimer has a Tm of −9.2 °C. The reverse primer has no hairpin, and the heterodimer between the two has a Tm of −1.7 °C and a ΔG of −2.57 kcal/mol. The 3′ end interactions are weak: −0.84 kcal/mol for the forward primer's 3′ end and −1.27 kcal/mol for the reverse.

Common misreadings

ΔG depends on the analysis temperature, so a hairpin can look stable at the default 37 °C and disappear at the annealing temperature. The forward EGFR hairpin has a ΔG of −1.10 kcal/mol at 25 °C and −0.31 kcal/mol at 37 °C, and Primer3 finds no hairpin at 60 °C. Wherever the hairpin is found, its Tm stays at 41.7 °C, which is why the structure Tm is the easier number to compare against an annealing temperature.

A large negative ΔG for a long self-dimer is not alarming on its own if its Tm is far below the reaction temperature. Tm values from different calculators also differ by several degrees when their conditions or methods differ; the comparison of oligo analyzers shows the same primer under each tool's defaults.

Molecular weight and OD260

Molecular weight (g/mol) is the average mass of the unmodified single-stranded oligo with hydroxyl ends: the sum of the nucleotide masses minus 61.96 g/mol. The extinction coefficient is the sum of fixed per-base values (A 15,200, C 7,050, G 12,010, T 8,400 M⁻¹ cm⁻¹) without nearest-neighbor base-stacking terms, so it can differ from a synthesis report that uses a nearest-neighbor model.

nmol / OD260 and µg / OD260 are the amount in one absorbance unit at 260 nm in 1 mL with a 1 cm path. The 28-nt forward EGFR primer is 8,628.67 g/mol with an extinction coefficient of 303,580 M⁻¹ cm⁻¹, giving 3.29 nmol and 28.42 µg per OD260. A 5′ phosphate, dye, quencher, linker or phosphorothioate changes the mass and can change absorbance.

Comparison with IDT OligoAnalyzer

IDT OligoAnalyzer uses the Allawi and SantaLucia (1997) DNA parameters with the Owczarzy 2004 and 2008 salt and Mg²⁺ corrections, finds hairpins with mfold, and by default assumes 0.25 µM oligo, 50 mM Na⁺ and no Mg²⁺. It also covers RNA, modified and degenerate oligos and single mismatches, and requires an IDT account. ProteinIQ is limited to unmodified DNA but screens every pair in a set of up to 24 oligos thermodynamically and keeps each run as a saved job.

Limits and next steps

The analyzer does not support RNA, degenerate bases, modified oligos, mismatch Tm calculations or genome-wide primer specificity, and it does not identify unintended amplicons. Hairpin and dimer results are sequence-level predictions; polymerase, target abundance, cycling program and competing molecules still decide experimental behavior.

Primer3 designs primers from a DNA template or checks supplied primers against template-level constraints. RNAfold folds RNA sequences. For a genome or transcriptome specificity screen, NCBI Primer-BLAST combines primer design with a database search.

FAQ

How accurate is the oligo analyzer?

The default SantaLucia (1998) parameters predicted the Tm of 26 duplexes with an average deviation of 2.2 °C after salt correction. The calculation is only as accurate as the conditions entered, so set the cation, dNTP, oligo, DMSO and formamide concentrations of the actual reaction. Hairpin and dimer results predict stability, not whether an assay will work.

Does the oligo analyzer account for DMSO and formamide?

Yes. DMSO (%), DMSO factor (°C per %) and Formamide (mol/L) apply Primer3's additive corrections to the Tm. They do not change hairpin, dimer or 3′ end-stability results, because Primer3's structure calculations do not take these concentrations.

Can I use the results in research?

Yes. Primer3 is open source and described in a peer-reviewed paper (Untergasser et al., 2012), and ProteinIQ calls its documented thermodynamic functions without changing them. Every job records the Primer3 version, method and concentrations, so the numbers can be reproduced with the same primer3-py release or cited with their conditions in a methods section.

Can I analyze oligos longer than 60 nucleotides?

Yes, up to 200 nt. You get Tm, GC, mass and OD260 values, and pairs with a partner of 60 nt or shorter still get heterodimer and 3′ end-stability results. Hairpin and self-dimer values are left blank because Primer3 does not align a single sequence longer than 60 nt, and the Tm comes from Primer3's long-sequence formula rather than nearest-neighbor thermodynamics.

Can the oligo analyzer handle RNA, modified or degenerate oligos?

No. It accepts unmodified DNA made of A, C, G and T, 8 to 200 nucleotides long; hairpin and dimer results stop at 60 nucleotides, the limit of Primer3's thermodynamic alignment. Fold RNA with RNAfold, and use the oligo supplier's calculator for dyes, quenchers, phosphorothioates and other modifications.

Sources

Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. (2012). Primer3: new capabilities and interfaces. Nucleic Acids Research 40(15): e115. DOI: 10.1093/nar/gks596

SantaLucia J Jr. (1998). A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proceedings of the National Academy of Sciences 95(4): 1460-1465. DOI: 10.1073/pnas.95.4.1460

Owczarzy R, You Y, Moreira BG, et al. (2004). Effects of sodium ions on DNA duplex oligomers: improved predictions of melting temperatures. Biochemistry 43(12): 3537-3554. DOI: 10.1021/bi034621r

Owczarzy R, Moreira BG, You Y, Behlke MA, Walder JA. (2008). Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry 47(19): 5336-5353. DOI: 10.1021/bi702363u

von Ahsen N, Wittwer CT, Schütz E. (2001). Oligonucleotide melting temperatures under PCR conditions: nearest-neighbor corrections for Mg2+, deoxynucleotide triphosphate, and dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clinical Chemistry 47(11): 1956-1961. DOI: 10.1093/clinchem/47.11.1956

Allawi HT, SantaLucia J Jr. (1997). Thermodynamics and NMR of internal G·T mismatches in DNA. Biochemistry 36(34): 10581-10594. DOI: 10.1021/bi962590c