Oligo analyzer

Analyze DNA oligos with thermodynamic secondary-structure checks

Oligo Analyzer is a DNA oligo property and primer secondary-structure calculator that runs Primer3 2.6.1 thermodynamic calculations for unmodified DNA. It reports melting temperature, hairpin and dimer stability, GC content, physical and optical properties, and the exact thermodynamic conditions used for the analysis. Oligo properties are always calculated for every submitted record. Turn on Analyze interactions when you also need dimer checks between different oligos; the analyzer selects the appropriate Primer3 calculation from the record count.

Enter each sequence 5′ to 3′. Paste the complete multi-record FASTA into the single sequence field or upload it as one file. Each FASTA header becomes that oligo's name in the result and export.

>EGFR_forward
CGTTCCAAAGATGTGGGCATGAGCTTAC
>EGFR_reverse
TACGGCATCCAGTTGAGTCA

Analysis

The sequence field accepts 1 to 96 named oligos and always returns independent properties for each one. Enable Analyze interactions to add pairwise heterodimer and 3′ end-stability results. Interaction analysis requires 2 to 24 oligos and reports up to 276 unordered pairs. The four underlying Primer3 execution paths are selected automatically from the number of records; they are not separate input modes.

Each record must be unmodified DNA made only from A, C, G, and T, with 8 to 60 nucleotides. Plain sequence text and multi-record .fasta, .fa, .fas, .seq, or .txt input are accepted. Whitespace is ignored and lowercase bases are normalized to uppercase.

The analyzer rejects RNA U, degenerate IUPAC bases, modifications, mixed-base order notation, and sequences outside the stated length range. These inputs require chemistry- or target-specific methods that are not represented by this calculation.

Reaction conditions and methods

Scientific settings are publicly inspectable and are not plan-gated once a run can be submitted. The defaults are intended as an inspectable starting point, not a PCR protocol.

Changing conditions can change the calculated Tm and structure energies. Results should therefore be compared only when their reported conditions and methods match.

Results

The result includes the Primer3 source version, selected conditions, and the named input sequence for each record. Exports preserve those names. Multi-oligo interaction output lists a pair only once, rather than repeating the same interaction in both orientations.

The output panel provides Data, Structures, Files, and a curated Logs tab. Data contains the complete per-oligo values; Files includes oligo-analysis.csv, oligo-analysis.json, and, when interactions are calculated, oligo-interactions.csv. The run log records selected conditions, input names and lengths, completed scientific phases, warnings, and result counts; it never contains sequences or infrastructure diagnostics.

Primer secondary-structure and dimer checks

For one record, the analyzer returns a hairpin result and a self-dimer result. This is the relevant output for a primer secondary-structure calculator, primer hairpin check, or self-dimer check. An interaction screen with exactly two records also returns the heterodimer result and two directional 3′ end-stability calculations, one for each primer's 3′ end against its partner.

An interaction screen with three or more records extends the same primer dimer check across every unordered pair in a set. It is intended for reviewing a bounded panel, not for genome-wide off-target analysis or primer design. Primer3 is the appropriate route for template-based primer design.

Reading structure results

ΔG is reported in cal/mol by Primer3. More negative values indicate a more favorable predicted structure under the selected conditions. Tm, ΔH, ΔS, and the returned ASCII structure provide the context needed to review a finding rather than reducing it to a generic “strong” label.

Hairpin and dimer calculations are sequence-level thermodynamic predictions. They do not establish whether a particular assay will fail. Polymerase, target abundance, cycling program, total reaction composition, and competing molecules still affect experimental behavior.

Limits and next steps

This tool does not support RNA, degenerate bases, modified oligos, mismatch Tm calculations, or genome-wide primer specificity checks. It does not identify unintended genomic amplicons.

Primer3 is the appropriate next step for designing primers from a DNA template or checking supplied primers with template-level constraints. ViennaRNA is the relevant structure-analysis route for RNA sequences, not DNA oligos. For a target-specific genome or transcriptome specificity screen, use NCBI Primer-BLAST, which combines primer information with database searching.

The molecular-weight and OD260 calculations apply only to the unmodified DNA chemistry accepted by this page. A phosphate, dye, quencher, linker, phosphorothioate, or other modification changes the relevant mass and may change absorbance.