RNA to DNA converter
v1.1.0Replace U with T while keeping the same strand orientation. Paste RNA or upload a sequence file.
Replace U with T while keeping the same strand orientation. Paste RNA or upload a sequence file.
Paste RNA or upload a FASTA, text, Word or PDF file, then select Convert. Each uracil (U) becomes thymine (T) while the strand orientation stays the same. Preview shows the converted sequences and record counts; Files contains the downloadable .fasta file and run.log.
For example, the mature hsa-miR-21-5p RNA sequence converts as follows with the default settings:
>hsa-miR-21-5p
UAGCUUAUCAGACUGAUGUUGA>dna_hsa-miR-21-5p
TAGCTTATCAGACTGATGTTGAThe default Prefix headers with dna_ option adds dna_ before each FASTA identifier. Header descriptions stay on the header line, even if they contain nucleotide letters such as RNA. For a multi-record input, each record is converted independently:
>hsa-miR-21-5p
UAGCUUAUCAGACUGAUGUUGA
>hsa-miR-16-5p
UAGCAGCACGUAAAUAUUGGCG>dna_hsa-miR-21-5p
TAGCTTATCAGACTGATGTTGA
>dna_hsa-miR-16-5p
TAGCAGCACGTAAATATTGGCGTo retain lowercase annotations, select Preserve original case, turn off Prefix headers with dna_, and choose No wrapping (single line). This input:
>mixed_case_RNA
aUgcuuAreturns:
>mixed_case_RNA
aTgcttA| Input | Details |
|---|---|
RNA input | One required input block or file containing a raw RNA sequence or multiple FASTA records. Supported uploads: .txt, .fasta, .fa, .fas, .seq, .docx and .pdf, up to 50 MB. Word and PDF files are read as extracted text; scanned images need text recognition first. |
With validation enabled, the converter accepts A, U, C, G, and the IUPAC ambiguity codes R, Y, S, W, N, K, M, B, D, H, and V. Alignment gap characters . and - are retained, so the length reported in the summary includes gap positions. Existing T characters are retained with a warning.
Wrapped lines and spaces are joined. Consistent position labels, such as 1 aug cuu 6, are removed; embedded or inconsistent digits are not silently discarded. Invisible document characters and typographic sequence punctuation are normalized. Lines starting with # or ; are treated as comments. These formatting changes appear in Logs.
Raw sequence text is written as a FASTA record. For example, AUGCUU produces the header >dna_Sequence and the sequence ATGCTT with the default header setting.
Give separate records their own FASTA headers. A plain list of wrapped sequences becomes one record. For names above sequences, spreadsheet columns or annotated GenBank records, use TXT to FASTA first. FASTQ input should pass through FASTQ to FASTA before conversion. A header and its sequence must be on separate lines.
| Setting | Options and behavior |
|---|---|
Output case | UPPERCASE (ATCG) is the default and converts sequence lines to uppercase. lowercase (atcg) lowercases sequence lines. Preserve original case keeps the capitalization of each input base while changing U to T. FASTA headers are not case-converted. |
Line wrapping | 80 characters per line (standard) is the default. Choose 60 characters per line for shorter FASTA lines, or No wrapping (single line) to place each converted sequence on one line. |
Validate input sequences | Enabled by default. Invalid or empty records are skipped with warnings if another record can be converted. A record containing T is allowed with a mixed-alphabet warning. When disabled, nonstandard symbols are retained and reported; empty records and recognized unsupported file formats still fail or are skipped. |
Prefix headers with dna_ | Enabled by default. Adds dna_ before each FASTA identifier, so >sample RNA becomes >dna_sample RNA. Turn it off to retain the original header text. Saved settings using the earlier label Add suffix to headers keep the same prefix behavior. |
| Output | Contents |
|---|---|
| Preview | Opens first. Shows copyable FASTA and a summary of converted records, sequence positions, U-to-T replacements and any skipped records. |
.fasta file | The same converted text as a downloadable file. An uploaded experiment.fa becomes experiment.fasta; pasted input downloads as converted.fasta. |
run.log | Conversion method, input and output record counts, skipped records, sequence positions, replacements, selected settings, warning count and formatting cleanup. It is downloadable from Files and viewable in Logs. It excludes input sequences and header text. |
Warnings identify records that need attention. A successful conversion can be partial, so check the skipped-record count before using the output. If every record is empty or invalid, the tool returns an error rather than an empty FASTA file.
This converter performs a notation change: U becomes T, while A, C, G, ambiguity symbols, and sequence order stay the same. It is useful when the same strand needs to be represented with DNA alphabet conventions for a FASTA file, a cloning workflow, or software that expects thymine instead of uracil.
This matches Biopython's back-transcription convention: the RNA is represented in the DNA coding-strand alphabet. It does not calculate the complementary first strand made by an enzymatic reverse-transcription reaction. For complementary DNA written in the usual 5' to 3' direction, use the reverse complement generator with RNA input, then convert that RNA result here.
| RNA character | DNA output |
|---|---|
A | A |
U | T |
C | C |
G | G |
| Goal | Best tool | Use when |
|---|---|---|
| RNA to DNA notation conversion | RNA to DNA converter | The sequence order should stay the same and each U should become T. |
| DNA to RNA transcription notation | DNA to RNA | A DNA-style sequence needs T changed to U. |
| Complementary RNA or DNA strand | Reverse complement | You need a complementary sequence, optionally in reverse orientation. |
| Create FASTA from named lists or tables | TXT to FASTA | Sequence names, spreadsheet columns or annotated records need to be separated from sequence data. Consistently numbered sequence lines can be pasted directly into RNA to DNA. |
| Convert sequencing reads to FASTA | FASTQ to FASTA | The input contains quality scores and FASTQ record markers. |
| Predict RNA secondary structure | RNAfold | The goal is to model folding rather than change the sequence alphabet. |
Paste the RNA sequence or upload a supported text or FASTA file, then run the converter. It changes each U to T and returns a FASTA-formatted DNA representation that can be copied or downloaded.
No. This tool preserves strand orientation and substitutes U with T. For complementary DNA in 5' to 3' orientation, reverse-complement the RNA using the RNA sequence type, then convert the result here.
Yes. A raw RNA sequence is accepted and written as a FASTA record. With the default header option, the generated header is >dna_Sequence.
Yes. Supply a FASTA file with one or more > headers. Each valid record is converted separately, retains its own header text, and is included in the same output file.
With validation enabled, records containing unsupported nucleotide characters are skipped. Empty records are always skipped. Preview reports how many records were skipped, and warnings explain which records need correction. If no record can be converted, the tool returns an error.
T is accepted as a nucleotide symbol, but it indicates DNA-style input where RNA convention normally expects U. The warning does not change or remove the existing T; it calls out the mixed alphabet so it can be checked before downstream use.
Yes. The supported IUPAC ambiguity codes are retained exactly, apart from the U to T substitution and the selected letter-case formatting. Alignment gaps . and - are retained as well.
Convert CSV or TSV sequence tables to FASTA with automatic delimiter detection and column mapping.
Convert coding-strand DNA to RNA notation by replacing thymine with uracil.
Paste or upload a sequence file in any common format and download FASTA. The format is detected automatically, and nothing leaves your browser.
Convert FASTA sequences to FASTQ with configurable mock Phred quality scores.
Convert FASTQ sequencing reads to FASTA while preserving headers and sequence case by default.
Convert GenBank records to FASTA by extracting primary sequences, CDS, or translations.
Paste or upload DNA, RNA, or protein text and download FASTA. Sequence names, wrapped lines, and tables are detected automatically, and nothing leaves your browser.
Extract CDS, mRNA, gene, rRNA, and tRNA features from GenBank records into FASTA.
Generate reverse, complement, or reverse-complement sequences from raw, FASTA, or FASTQ DNA and RNA input.
Translate DNA sequences into proteins across reading frames and genetic code tables.