RNA to DNA converter

How to convert RNA to DNA

Paste an RNA sequence or upload a FASTA file, choose the output formatting, then select Convert. The RNA to DNA converter changes every uracil (U) to thymine (T), keeps the sequence order and supported ambiguity symbols, and returns a copyable, downloadable .fasta file. It accepts a single raw sequence as well as multiple FASTA records.

For example, the mature hsa-miR-21-5p RNA sequence converts as follows with the default settings:

>hsa-miR-21-5p
UAGCUUAUCAGACUGAUGUUGA

>dna_hsa-miR-21-5p
TAGCTTATCAGACTGATGTTGA

The default header option adds dna_ at the beginning of each FASTA identifier. For a multi-record input, each record is converted independently:

>hsa-miR-21-5p
UAGCUUAUCAGACUGAUGUUGA
>hsa-miR-16-5p
UAGCAGCACGUAAAUAUUGGCG

>dna_hsa-miR-21-5p
TAGCTTATCAGACTGATGTTGA
>dna_hsa-miR-16-5p
TAGCAGCACGTAAATATTGGCG

To retain lowercase annotations, select Preserve original case, turn off Add suffix to headers, and choose No wrapping (single line). This input:

>mixed_case_RNA
aUgcuuA

returns:

>mixed_case_RNA
aTgcttA

Input

With validation enabled, the converter accepts A, U, C, G, and the IUPAC ambiguity codes R, Y, S, W, N, K, M, B, D, H, and V. Alignment gap characters . and - are also accepted and retained. Whitespace within a sequence is removed before conversion.

Raw sequence text is written as a FASTA record. For example, AUGCUU produces the header >dna_Sequence and the sequence ATGCTT with the default header setting.

Settings

Results

There is no separate report file. The conversion records the number of successful sequences and their total length, while validation messages are returned as warnings.

What does RNA to DNA conversion mean here?

This converter performs a notation change: U becomes T, while A, C, G, ambiguity symbols, and sequence order stay the same. It is useful when the same strand needs to be represented with DNA alphabet conventions for a FASTA file, a cloning workflow, or software that expects thymine instead of uracil.

It does not simulate an enzymatic reverse-transcription reaction and does not calculate the complementary strand. A cDNA synthesized from an RNA template is complementary to that template. When you need the reverse, complement, or reverse-complement sequence, use the reverse complement generator and select RNA as the sequence type.

Which sequence converter should I use?

FAQ

How do I convert an RNA sequence to DNA?

Paste the RNA sequence or upload a supported text or FASTA file, then run the converter. It changes each U to T and returns a FASTA-formatted DNA representation that can be copied or downloaded.

Does RNA to DNA conversion create complementary DNA?

No. This tool preserves the sequence orientation and only substitutes U with T. For a complementary DNA or RNA strand, use the reverse complement generator with the appropriate sequence type.

Can I convert RNA without a FASTA header?

Yes. A raw RNA sequence is accepted and written as a FASTA record. With the default header option, the generated header is >dna_Sequence.

Can I convert multiple RNA sequences at once?

Yes. Supply a FASTA file with one or more > headers. Each valid record is converted separately, retains its own header text, and is included in the same output file.

Why does the converter warn that my RNA contains T?

T is accepted as a nucleotide symbol, but it indicates DNA-style input where RNA convention normally expects U. The warning does not change or remove the existing T; it calls out the mixed alphabet so it can be checked before downstream use.

Are RNA ambiguity codes preserved?

Yes. The supported IUPAC ambiguity codes are retained exactly, apart from the U to T substitution and the selected letter-case formatting. Alignment gaps . and - are retained as well.