Protein to DNA converter

How to convert protein to DNA?

The easiest way to convert protein to DNA online is to use this ProteinIQ protein to DNA converter. Paste a protein sequence in FASTA format or upload a file, choose your expression host and options, then run the tool. ProteinIQ reverse translates each amino acid to a codon, optimizes codon usage for your target organism, and returns a .fasta file with the DNA sequence along with a summary of GC content and Codon Adaptation Index.

Reverse translation is not deterministic. Because the genetic code is degenerate, most amino acids map to several codons, so one protein can be encoded by a huge number of DNA sequences. This reverse translation tool chooses the codons for you using the strategy you select, so the output is one valid coding sequence rather than the single "correct" answer.

For a single protein, the result is one FASTA record. The example below uses the human expression host with the most frequent codon for each amino acid:

>insulin_A_fragment
GGCATCGTGGAGCAGTGCTGCTGA

The input GIVEQCC becomes the DNA above, and a stop codon (TGA) is appended at the end because stop codons are added by default.

For several proteins, paste them as a multi-record FASTA file and each one is translated separately:

>protein1
ATGAAGCTGCTGATCCTGACCTGCCTGGTG...
>protein2
GTGGCCCCCTTCCCCGAGGTGTTCGGC...

To go from amino acid to a degenerate DNA sequence for primer design, switch the output mode to degenerate. Each residue collapses to IUPAC ambiguity codes that cover every possible codon:

>peptide
GGNATHGTNGARCARTGYTGY

Input

Valid input uses the 20 standard one-letter amino acid codes. The converter also accepts ambiguity and extended codes (B, Z, J, X, U, O) and a terminal stop marker (*). Internal stop codons are removed before translation and reported in the summary.

Settings

Results

What is reverse translation?

Reverse translation, also called back translation, is the process of converting a protein into a DNA sequence that could encode it. Forward translation (DNA to protein) follows a deterministic one-to-one mapping, but going from protein to DNA means choosing among many possible codons.

For a protein of just 100 amino acids there can be billions of different DNA sequences that encode exactly the same protein. Reverse translation is essential for gene synthesis, codon optimization for heterologous expression, designing primers for molecular cloning, and protein engineering when you need to work backward from a known protein sequence.

The degenerate genetic code

The genetic code uses 64 three-nucleotide codons to specify 20 standard amino acids plus start and stop signals, so multiple codons encode a single amino acid.

Only methionine (M) and tryptophan (W) have single codons (ATG and TGG), while leucine, serine, and arginine each have six codon options. The variation usually falls in the third "wobble" position.

This degeneracy buffers against mutations. A point mutation in the third position often produces a synonymous change that keeps the original amino acid, so protein structure is preserved.

Codon usage bias

Different organisms prefer different synonymous codons even though they encode the same amino acid. This preference, called codon usage bias, reflects the abundance of different tRNA molecules in each organism.

Using rare codons can slow translation or lower protein yield, while matching codons to the target organism can increase expression. The table below shows a few examples.

Codon choice also affects mRNA secondary structure, translation kinetics, and co-translational folding. Some proteins rely on strategically placed rare codons to pause the ribosome for correct folding, which is why matching the host distribution is often better than always using the single best codon.

How to optimize codons for expression

Codon optimization tunes a coding sequence so it expresses well in a chosen host. The workflow with this converter is:

• Pick your real expression host, or paste a custom codon usage table if your organism is not listed.
• Choose a codon selection strategy. Match host frequency is the recommended default because it avoids the repetitive sequences that come from always using the top codon. Most frequent codon gives the highest Codon Adaptation Index.
• Turn on Avoid restriction sites if you are cloning into a vector, and Avoid long repeats if you plan to order the gene from a synthesis vendor.
• Check the GC content and Codon Adaptation Index in the summary file, then adjust the strategy if needed.

The Codon Adaptation Index (CAI) measures how closely a sequence matches the host's preferred codons on a scale from 0 to 1. Highly expressed native genes usually sit between 0.7 and 1.0.

Which translation tool should I use?

Use this protein to DNA converter to reverse translate a protein, amino acid, or peptide sequence into a nucleotide sequence. Use a different tool when you are working in the other direction or with a different input.

FAQ

Can you go from protein to DNA?

Yes, but not uniquely. Because most amino acids are encoded by several codons, a single protein can be encoded by an astronomical number of DNA sequences, typically $10^{30}$ to $10^{60}$ for a 100-residue protein. A reverse translation tool selects one valid coding sequence, and codon optimization picks codons that match your target organism so the gene is more likely to express well.

How do I convert a protein sequence to a DNA sequence?

Paste the protein sequence in FASTA format or upload a file, choose an expression host and codon selection strategy, then run the converter. The tool reverse translates each amino acid to a codon and returns a DNA .fasta file plus a summary with GC content and Codon Adaptation Index.

How do I convert an amino acid sequence to a nucleotide sequence?

It is the same process as converting protein to DNA. Each amino acid is mapped to a codon, so an amino acid or peptide sequence becomes a nucleotide sequence. Use the degenerate output mode if you want an amino acid to nucleotide consensus for primer design rather than a single sequence.

Is reverse translation accurate?

The reverse-translated DNA always encodes exactly the protein you entered, so it is 100% accurate at the amino acid level. Expression levels vary: codon-optimized sequences often express several times better than random codon choice, but results depend on the protein, host, promoter, and mRNA stability. The generated DNA will almost never match the natural gene, so use a database like NCBI or UniProt if you need the real genomic sequence.

How do I design degenerate PCR primers from a protein?

Switch the output mode to degenerate consensus. The tool returns IUPAC ambiguity codes that cover every codon capable of encoding your protein. Take a short, low-degeneracy stretch (regions rich in Met and Trp are ideal because they are unambiguous) and order it as a degenerate primer to amplify the gene from genomic or cDNA template.

Can I reverse translate protein to RNA?

Yes. Set the output type to RNA and the converter outputs the sequence with uracil (U) instead of thymine (T), which is useful for mRNA and in vitro transcription workflows.

What genetic codes are supported?

All 18 common NCBI translation tables, including the standard code, vertebrate and invertebrate mitochondrial codes, yeast mitochondrial, bacterial and plastid, ciliate nuclear, and several other organellar codes. Use the standard code for nuclear genes and pick an organellar code only when working with mitochondrial or plastid sequences.