Protein to DNA converter

How to convert protein to DNA?

Paste a protein or amino acid sequence, or upload a FASTA file. Choose whether you want one concrete coding sequence or a degenerate IUPAC consensus, select the genetic code and codon-usage options, then run the converter. ProteinIQ returns a downloadable FASTA file and a conversion summary.

Protein to DNA conversion is also called reverse translation or back translation. It does not recover the original gene. Most amino acids have several synonymous codons, so many DNA sequences can encode the same protein. This tool makes those codon choices explicit and reproducible.

For example, the protein fragment GIVEQCC, using the human preset and the most frequent codon for each residue, produces:

>Converted Sequence
GGCATCGTGGAGCAGTGCTGCTGA

The final TGA is present because Add stop codon is enabled by default. With a fixed random seed, frequency-matched and random codon choices produce the same result again when the input and settings are unchanged.

For a degenerate primer consensus, MKW produces:

>Converted Sequence
ATGAARTGG

Here AAR represents the two lysine codons, AAA and AAG.

Input

The converter accepts the 20 standard one-letter amino acid codes, ambiguity codes B, Z, J, and X, the recoded residues U and O, and one terminal stop marker (*). An internal * is rejected because silently joining residues across a stop would change the requested protein. By default, ambiguous and recoded residues become NNN so uncertainty is preserved.

Settings

Results

What is reverse translation?

Forward translation maps each coding codon to an amino acid. Reverse translation starts with the protein and must choose among synonymous codons. It therefore generates a possible coding sequence rather than reconstructing the natural genomic or transcript sequence.

Reverse translation is useful when preparing a coding sequence for gene synthesis, generating a host-aware design, or making a degenerate nucleotide sequence for primer design. To check the other direction, use the DNA to protein converter. For cloning primer design around a known DNA template, use Primer3.

Codon usage presets and CAI

The eight presets use pinned organism-level records from the Kazusa Codon Usage Database methodology, which tabulated GenBank Release 160.0 in June 2007. The source taxonomy record and coding-sequence count are stored with each preset so results do not change silently. The presets cover Homo sapiens, Mus musculus, Cricetulus griseus, Escherichia coli W3110, Saccharomyces cerevisiae, Pichia pastoris, Spodoptera frugiperda, and Arabidopsis thaliana.

These preset tables use standard-code codon assignments. ProteinIQ applies them with Standard (1) and Bacterial/Plastid (11). If you select a genetic code with reassigned codons, provide a custom table built for that code; otherwise host-frequency and most-frequent selection fall back to seeded random synonymous codons, and GC-biased selection runs without preset frequency tie-breaking.

These aggregate organism records are useful heuristics, not expression guarantees. They do not model a specific strain or cell line unless the source record itself does. Expression also depends on promoter choice, RNA structure, transcript stability, translation kinetics, protein folding, and the experimental system. You can inspect predicted coding-RNA structure with RNAfold.

The Codon Adaptation Index (CAI) summarizes how strongly a concrete sequence favors the highest-weight synonymous codons in the selected table. ProteinIQ follows the relative-adaptiveness concept introduced by Sharp and Li. CAI is a comparative design metric, not a universal pass/fail threshold or a prediction of protein yield.

Genetic-code mappings follow the supported NCBI genetic code tables. A codon-usage table changes which synonymous codon is preferred; it does not change which amino acid a codon encodes.

Single sequence or degenerate consensus?

Use single-sequence output when you need one concrete coding sequence. Use degenerate output when a nucleotide position must represent every synonymous codon for the protein segment, such as an amino acid to nucleotide consensus for a degenerate primer.

Degenerate consensus can grow highly complex for residues with many codons. It also does not optimize for a host or guarantee that every combination represented by the IUPAC sequence encodes only the intended peptide. Check the resulting degeneracy and primer properties before ordering oligonucleotides.

A practical reverse-translation workflow

1. Confirm the protein sequence and whether a terminal * is intentional.
2. Choose the genetic code for the biological system.
3. Select a host preset, paste a custom codon table, or leave the host unset.
4. Choose frequency matching for a host-weighted design, or another strategy for a specific GC or codon-choice goal.
5. Keep the seed with your design record so the sequence can be regenerated.
6. If relevant, enable restriction-site and repeat reduction, then review any remaining liabilities in the summary.
7. Translate the result back with DNA to protein and perform any synthesis-vendor or construct-specific checks required for your experiment.

Related sequence tools

FAQ

Can you convert a protein back to DNA?

You can generate DNA that encodes the protein, but you cannot infer the unique original gene from the protein alone. Synonymous codons, untranslated regions, introns, regulatory sequences, and genomic context are not recoverable from an amino acid sequence.

Does protein to DNA conversion preserve the amino acid sequence?

Standard residues and a supported terminal stop are reverse translated according to the selected genetic code. Ambiguous or recoded residues need an explicit policy: the default NNN preserves nucleotide uncertainty, representative mode makes a stated biological substitution, and remove mode changes the sequence. Ensure start codon also adds a methionine when needed. Review these warnings before using the result.

Can I translate protein to mRNA?

Select RNA output to receive a coding sequence with U instead of T. This is suitable as a coding-RNA starting point, but it is not a full mature mRNA design because the converter does not add untranslated regions, a 5' cap, a poly(A) tail, or modified nucleotides.

Which expression-host preset should I choose?

Choose the preset that matches the intended organism-level system, or provide a custom table when you have a more relevant strain, tissue, cell line, or expression-specific dataset. Do not treat the Chinese hamster preset as a CHO-cell-line table or the fall armyworm preset as an Sf9-cell-line table.

Why does the same protein have many possible DNA sequences?

The genetic code is degenerate: most amino acids are encoded by more than one codon. A protein containing many such residues can therefore have a very large number of synonymous coding sequences.

Are restriction sites and repeats guaranteed to be removed?

No. The converter attempts synonymous substitutions while preserving the encoded standard residues. Some motifs cannot be removed because no suitable synonymous alternative exists or because changes create another liability. Remaining sites and repeat liabilities appear in the warnings and summary.

What happens to an internal stop marker?

The affected FASTA record is rejected and reported. The converter never silently deletes an internal * and joins the surrounding residues.