FASTA to FASTQ converter

What is FASTQ?

FASTQ is a text-based format for storing both biological sequences (usually nucleotide sequences) and their corresponding quality scores. It's the standard format for raw sequencing data from high-throughput sequencing platforms.

Each sequence entry in FASTQ takes exactly 4 lines:

1. Header line: Starts with @ followed by sequence identifier and optional description
2. Sequence line: The actual nucleotide or amino acid sequence
3. Separator line: Starts with + (optionally followed by the same info as line 1)
4. Quality line: ASCII-encoded quality scores (same length as sequence)

Example:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

I'll fetch that Wikipedia page to give you the precise details about FASTQ quality scores.Great question! In FASTQ files, the quality scores represent the probability that the corresponding base call is incorrect.

What the scores mean?

The quality value (Q) is an integer that maps the probability (p) that a base call is wrong. Most commonly, this uses the Phred quality score formula:

Q = -10 × log₁₀(p)

So for example:

• Q = 10 means 1 in 10 chance the base is wrong (90% accuracy)
• Q = 20 means 1 in 100 chance the base is wrong (99% accuracy)
• Q = 30 means 1 in 1,000 chance the base is wrong (99.9% accuracy)
• Q = 40 means 1 in 10,000 chance the base is wrong (99.99% accuracy)

The quality scores use Phred quality scores encoded as ASCII characters for brevity, with the byte representing quality running from 0x21 (lowest quality; '!' in ASCII) to 0x7e (highest quality; '~' in ASCII).

The most common modern format (Sanger/Illumina 1.8+) uses Phred+33 encoding, where you add 33 to the quality score to get the ASCII character.